Σάββατο, 26 Ιανουαρίου 2013

Βλαστοκύτταρα: Βρετανός «καλλιεργεί» νέα μύτη στο χέρι του


Ένας 53χρονος Βρετανός που έχασε τη μύτη του εξαιτίας καρκίνου του δέρματος, πρόκειται σύντομα να αποκτήσει μια καινούρια, η οποία ήδη αναπτύσσεται πάνω στο μπράτσο του με τη βοήθεια δικών του βλαστοκυττάρων. Το πρωτοποριακό εγχείρημα -που ακόμα δεν έχει επίσημα επιβεβαιωθεί- πραγματοποιούν επιστήμονες του University College του Λονδίνου, με επικεφαλής τον καθηγητή αναγεννητικής ιατρικής Άλεξ Σεϊφαλιάν, σύμφωνα με τον Independent.

Οι ερευνητές διαβεβαιώνουν ότι η νέα μύτη θα μοιάζει ακριβώς ίδια με την προηγούμενη και αισιοδοξούν ότι μπορεί να έχει σε ένα βαθμό και την αίσθηση της όσφρησης.

Είναι η πρώτη φορά που επιχειρείται να αναπτυχθεί μια νέα μύτη τελείως από το μηδέν και, αν πετύχει, τότε στο μέλλον η θεραπεία θα μπορεί να εφαρμοστεί σε θύματα τροχαίων, τραυματίες πολέμων κ.ά.

Σε πρώτη φάση, οι Βρετανοί επιστήμονες δημιούργησαν ένα γυάλινο εκμαγείο της μύτης του άνδρα και την ψέκασαν με ένα ειδικό υλικό, ώστε να σχηματιστεί μια βιολογική «σκαλωσιά» πάνω στην οποία μπορούσαν να προσαρτηθούν τα νέα κύτταρα. Στη συνέχεια, αφαιρέθηκε το γυάλινο εκμαγείο και η «σκαλωσιά» επικαλύφθηκε με εκατομμύρια βλαστικά κύτταρα που, με τη βοήθεια χημικών ουσιών, αναπρογραμματίστηκαν για να αναδημιουργήσουν χόνδρους.

Ταυτόχρονα, οι γιατροί τοποθέτησαν ένα μπαλονάκι κάτω από την επιφάνεια του μπράτσου του άνδρα και βαθμιαία το φούσκωσαν, ώστε να τεντώσουν το δέρμα για να χωρέσει σε αυτό το σημείο η υπό ανάπτυξη νέα μύτη. Πριν από δύο μήνες, τοποθετήθηκε εκεί η «σκαλωσιά» με τα βλαστοκύτταρα και μέχρι σήμερα η υπό δημιουργία μύτη μεγαλώνει σιγά-σιγά πάνω στο χέρι του ασθενούς, αναπτύσσοντας τα νεύρα, τα αιμοφόρα αγγεία και το δέρμα που έχει μια κανονική μύτη.

Μετά από τρεις μήνες, η μύτη θα είναι έτοιμη να αφαιρεθεί και χειρουργικά να προσκολληθεί στο πρόσωπο του άνδρα, ενώ το μπράτσο θα επιστρέψει στην κανονική κατάστασή του με τα κατάλληλα ράμματα.

Όπως είπε μάλιστα ο Άλεξ Σεϊφαλιάν, πρότεινε στον άνδρα η νέα μύτη του να είναι απολύτως ίσια, όμως εκείνος αρνήθηκε και επέμεινε πως ήθελε και η νέα μύτη του να είναι ελαφρώς στραβή, όπως η χαμένη αυθεντική του. Μάλιστα, ο Βρετανός καθηγητής αποκάλυψε πως αναπτύσσει ταυτόχρονα δύο μύτες για τον άτυχο 53χρονο, σε περίπτωση που κάτι πάει στραβά με τη μία.

tvxs.gr

Πέμπτη, 24 Ιανουαρίου 2013

Ερευνητές αποθήκευσαν όλα τα σονέτα του Shakespeare και αρχεία MP3 σε ακολουθία DNA! Υπόσχονται 2.2PB σε 1 γραμμάριο DNA!

Το περασμένο καλοκαίρι μάθαμε για τα επιτεύγματα ερευνητών των Stanford University και Harvard, με τους πρώτους να μετατρέπουν το DNA ζωντανών οργανισμών σε μονάδες αποθήκευσης ψηφιακών δεδομένων και τους δεύτερους να αποθηκεύουν βιβλίο 53.000 λέξεων, εικόνες και πρόγραμμα JavaScript σε ακολουθίες DNA.


Τέτοια κατορθώματα δε θα μπορούσαν να περάσουν απαρατήρητα από άλλα ερευνητικά ιδρύματα και τώρα έρχεται η σειρά του EMBL-European Bioinformatics Institute να ανακοινώσει στο επιστημονικό περιοδικό Nature ότι κατάφεραν να αποθηκεύσουν-κωδικοποιήσουν όλα τα σονέτα του Shakespeare (αρχείο .txt), απόσπασμα της ομιλίας “I Have A Dream” του Martin Luther King (αρχείο .MP3), φωτογραφία του EMBL-EBI (αρχείο .jpeg), τη δημοσίευση των Watson-Crick (αρχείο .PDF) και ένα αρχείο που περιγράφει την κωδικοποίηση, σε βάσεις DNA.


Για να επιτευχθεί η κωδικοποίηση έπρεπε να μεταφραστούν τα ψηφιακά δεδομένα από το δυαδικό (binary) σύστημα σε ένα τριαδικό σύστημα, το οποίο εμπνεύστηκαν οι ερευνητές με γνώμονα τον αριθμό των αζωτούχων βάσεων (A, T, G, C) που απαιτούνται για το σχηματισμό ενός DNA κωδικόνιου (π.χ. ATG, TAG).


Μάλιστα, αποφάσισαν να θεωρήσουν τη μία από τις 4 αζωτούχες βάσεις αμελητέα έτσι ώστε να αποφευχθούν τα συχνά λάθη μετάφρασης που προκύπτουν όταν μία από τις βάσεις επαναλαμβάνεται συνεχώς σε μια ακολουθία DNA.

Δηλαδή, σε μια ακολουθία αυτής της μορφής “ATGGACTTACCACCCCCCCCCTAG” αν θεωρήσουμε αμελητέα τη βάση γουανίνη (G), τότε θα μπορούσαμε να γράψουμε το κομμάτι όπου επαναλαμβάνεται η κυτοσίνη (C) ως εξής “CCGCGCGCC”, χωρίς να αλλάζει το νόημα που κρύβει.
Στη συνέχεια, η ακολουθία χωρίζεται σε τριάδες όπως αναφέραμε προηγουμένως, με τη καθεμια από αυτές να έχει συγκεκριμένη “ταυτότητα” και θέση στο τελικό “αρχείο DNA”.

Με αυτόν τον τρόπο, οι ερευνητές ισχυρίζονται ότι μπορούν να αποθηκεύσουν 2.2PB (1PB = 1000TB = 1.000.000GB) σε 1 γραμμάριο DNA! Για να εντυπωσιαστείτε ακόμα περισσότερο, να σημειώσουμε ότι ένας τέτοιος “βιολογικός σκληρός δίσκος” μπορεί να διατηρήσει την πληροφορία για 5-10 χιλιάδες χρόνια αν καταψυχθεί, ωστόσο, οι ερευνητές φιλοδοξούν ότι μέσα στα επόμενα χρόνια θα καταφέρουν να κατασκευάσουν πιο “οικονομικά μοντέλα” με διάρκεια ζωής περίπου 50 χρόνια.

techgear.gr 




Δευτέρα, 21 Ιανουαρίου 2013

Λευκοκύτταρο επιτίθεται σε βακτήριο!



Το μεγάλο κύτταρο που αλλάζει σχήμα και κινείται είναι λευκοκύτταρο
Τα ακίνητα σφαιρικά είναι ερυθροκύτταρα και τα μικρά μαύρα που μοιάζουν με "8" είναι βακτήρια.


Τετάρτη, 2 Ιανουαρίου 2013

Εισερχόμενος κομήτης υπόσχεται φαντασμαγορικό σόου!

Καλλιτεχνική απεικόνιση του κομήτη ISON που αναμένεται να κάνει εντυπωσιακή είσοδο στη διαστημική μας γειτονιά


 Θα είναι πιο λαμπρός από τη Σελήνη κατά το πέρασμά του!

Ουάσινγκτον 
Ενας κομήτης που εντοπίστηκε τον Σεπτέμβριο από αστρονόμους στη Ρωσία δεν αποκλείεται να γίνει τόσο λαμπρός στα τέλη του 2013 ώστε να είναι ορατός ακόμα και στο φως της ημέρας.

Διαστημική χιονόμπαλα

Η τροχιά στην οποία κινείται η διαστημική χιονόμπαλα, επισημαίνουν οι ερευνητές, παρουσιάζει σημαντικές ομοιότητες με την τροχιά του «Μεγάλου Κομήτη του 1680», ο οποίος έγινε ορατός στη διάρκεια της ημέρας και σχημάτισε μια ουρά με μήκος μεγαλύτερο από το πλάτος της Σελήνης.

Η ομοιότητα των τροχιών υποδεικνύει ότι τα δύο σώματα σχετίζονται ή ότι πρόκειται για τον ίδιο κομήτη. O νέος κομήτης, με την ονομασία Comet ISON ή C/2012 S1, εντοπίστηκε στα μέσα Σεπτεμβρίου με τηλεσκόπιο του Διεθνούς Επιστημονικού Οπτικού Δικτύου (ISON) κοντά στο Κισλοβόντσκ στην περιοχή του Βόρειου Καυκάσου. Βρισκόταν τότε σε απόσταση ενός δισεκατομμυρίου χιλιομέτρων από τη Γη.

Το σόου

Ο C/2012 S1 θα αρχίσει να γίνεται ορατός με γυμνό μάτι τον Οκτώβριο του 2013, όταν θα φαίνεται να κινείται τις πρώτες πρωινές ώρες ανάμεσα στα άστρα του αστερισμού του Λέοντα.

Το μεγάλο σόου θα αρχίσει όταν ο κομήτης πλησιάσει τον Ήλιο, οπότε οι πάγοι της επιφάνειάς του θα αρχίσουν να εξαερώνονται από την ακτινοβολία και πιθανώς θα σχηματίσουν μια ουρά που εκτείνεται για χιλιάδες ή και εκατομμύρια χιλιόμετρα στο Διάστημα. Το φαινόμενο θα κορυφωθεί όταν ο κομήτης φτάσει στο περιήλιο, δηλαδή στην ελάχιστη απόστασή του από τον Ήλιο, στις 28 Νοεμβρίου 2013. Υπό την επίδραση της ακραίας βαρύτητας του Ήλιου, ο C/2012 S1 θα πραγματοποιήσει μια κλειστή στροφή πίσω από το άστρο για να εμφανιστεί και πάλι στην άλλη πλευρά του.

Τι θα πάθει;


Κανείς δεν γνωρίζει αν ο κομήτης θα επιζήσει αλώβητος ή αν θα σπάσει σε κομμάτια. Κανείς δεν μπορεί να προβλέψει επίσης πόσο μακριά και φωτεινή θα είναι η ουρά του, αν και οι αστρονόμοι ελπίζουν σε ένα από τα πιο θεαματικά περάσματα των τελευταίων δεκαετιών.

Δεδομένου ότι οι κομήτες θεωρούνται κατάλοιπα από το σχηματισμό του Ηλιακού Συστήματος πριν από 4,5 δισ. χρόνια, οι επιστήμονες θα παρακολουθούν τον C/2012 S1 αναζητώντας στοιχεία για τη σύστασή του. Οι περισσότεροι κομήτες προέρχονται από το Νέφος του Όορτ, ένα «σύννεφο» παγωμένων, αρχαίων σωμάτων που περιφέρονται αργά σε απόσταση περίπου ενός έτους φωτός από τον Ήλιο.

tovima.gr